View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4201-Insertion-23 (Length: 136)
Name: NF4201-Insertion-23
Description: NF4201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4201-Insertion-23 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 8 - 136
Target Start/End: Original strand, 6361134 - 6361261
Alignment:
| Q |
8 |
gctatgatatcattgaagtgtgcaggtgctaacttaagtgtgaatatctgtacattaattacaaataatatttgttaggattatccaatatatcaagtag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6361134 |
gctatgatatcattgaagtgtgcaggtgctaact-aagtgtaaatatctgtacattaattacaaataatatttgttaggattatccaatatatcaagtag |
6361232 |
T |
|
| Q |
108 |
aacctctccatacatgctgttacttggta |
136 |
Q |
| |
|
||||||| |||||||| |||||||||||| |
|
|
| T |
6361233 |
aacctctacatacatgttgttacttggta |
6361261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University