View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4201-Insertion-25 (Length: 89)
Name: NF4201-Insertion-25
Description: NF4201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4201-Insertion-25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 1e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 8 - 80
Target Start/End: Complemental strand, 9740382 - 9740310
Alignment:
| Q |
8 |
atttaatcttgtgatcatacaaaacttgctctttgtacccctacccattacaaaagaaatgtgtttaccacta |
80 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9740382 |
atttaatcttgtgatcatataaaacttgctctttgtacccctacccattacaaaagaaatgtgtttaccacta |
9740310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 8 - 73
Target Start/End: Complemental strand, 9753783 - 9753718
Alignment:
| Q |
8 |
atttaatcttgtgatcatacaaaacttgctctttgtacccctacccattacaaaagaaatgtgttt |
73 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
9753783 |
atttaatcttgtgatcatacaaaatttgctctttgtactcctacccattacaaaagaaacgtgttt |
9753718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University