View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4201_low_6 (Length: 332)
Name: NF4201_low_6
Description: NF4201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4201_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 3 - 91
Target Start/End: Original strand, 46875338 - 46875425
Alignment:
| Q |
3 |
tgtattcagtggatggttgtagaattgatttgatggtcattttgcataaagctagtaagagatatgtttaagggtgtcacttaccagtg |
91 |
Q |
| |
|
|||||||| | |||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||| |||||| |||||||| |||| |
|
|
| T |
46875338 |
tgtattcacttgatggttgtagaat-gatttgatggtcattttgcataaagctagtgagaaatatgttcaagggtctcacttactagtg |
46875425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 204 - 267
Target Start/End: Original strand, 46876140 - 46876204
Alignment:
| Q |
204 |
atatcatgaatca-tggttttagtttcctacatctctgctttctttttaaacatatttttggacc |
267 |
Q |
| |
|
||||||||| ||| ||||||||| |||||||| ||||| |||| || ||||||||||||||||| |
|
|
| T |
46876140 |
atatcatgagtcaatggttttagcgtcctacatatctgcattctgttgaaacatatttttggacc |
46876204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University