View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4201_low_6 (Length: 332)

Name: NF4201_low_6
Description: NF4201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4201_low_6
NF4201_low_6
[»] chr3 (2 HSPs)
chr3 (3-91)||(46875338-46875425)
chr3 (204-267)||(46876140-46876204)


Alignment Details
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 3 - 91
Target Start/End: Original strand, 46875338 - 46875425
Alignment:
3 tgtattcagtggatggttgtagaattgatttgatggtcattttgcataaagctagtaagagatatgtttaagggtgtcacttaccagtg 91  Q
    |||||||| | |||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||| |||||| |||||||| ||||    
46875338 tgtattcacttgatggttgtagaat-gatttgatggtcattttgcataaagctagtgagaaatatgttcaagggtctcacttactagtg 46875425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 204 - 267
Target Start/End: Original strand, 46876140 - 46876204
Alignment:
204 atatcatgaatca-tggttttagtttcctacatctctgctttctttttaaacatatttttggacc 267  Q
    ||||||||| ||| |||||||||  |||||||| ||||| |||| || |||||||||||||||||    
46876140 atatcatgagtcaatggttttagcgtcctacatatctgcattctgttgaaacatatttttggacc 46876204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University