View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4202_low_10 (Length: 314)
Name: NF4202_low_10
Description: NF4202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4202_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 6 - 300
Target Start/End: Original strand, 42967477 - 42967767
Alignment:
| Q |
6 |
ctcaaagtctaaagttcgattctactcataactaatttagatgggttaatattttaatgagcgtttaaatttatagattgtgtacatccatttccagtag |
105 |
Q |
| |
|
|||||||||||| |||||||||| || |||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
42967477 |
ctcaaagtctaaggttcgattct---cagaactaatttagatgggttaatattttaaccagcttttaaatttatagattgtgcacatccatttc-agtag |
42967572 |
T |
 |
| Q |
106 |
catcaaatctacaaacagaaaaggctcccaatggatgcacacactctagtggtggctctgtcacttgatacacacaatctaatgctctctatcaactcaa |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42967573 |
catcaaatctacaaagagaaaaggctcccaatggatgcacacactctagtggtggctctgtcacttgatacacacaatctaatgctctctatcaactcaa |
42967672 |
T |
 |
| Q |
206 |
ggtcaaattcagtcctttcacacccagatagatcccttcttttgtggatacaatgcaaccacaagcagaagtgagtaattgttcatcaccggttc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42967673 |
ggtcaaattcagtcctttcacacccagatagatcccttcttttgtggatacaatgcaaccacaagcagaagtgagtaattgttcatcaccggttc |
42967767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University