View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4203_high_8 (Length: 281)
Name: NF4203_high_8
Description: NF4203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4203_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 151 - 266
Target Start/End: Complemental strand, 35935418 - 35935303
Alignment:
| Q |
151 |
aatttacattatgttccttgaaattgtgaaaattaccgatgaatacagttaccatgaagttgcataaatctctaaaaccataatagttcgactaaaactg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35935418 |
aatttacattatgttccttgaaattgtgaaaattaccgatgaatacagttaccatgaagttgcataaatgtctaaaaccataatagttcgactaaaactg |
35935319 |
T |
|
| Q |
251 |
tagtaagccaatatac |
266 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35935318 |
tagtaagccaatatac |
35935303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 17 - 84
Target Start/End: Complemental strand, 35935553 - 35935486
Alignment:
| Q |
17 |
agtattgtggctcaatggaggtaaaaatagcctcacaaactgttttatgctgataataacttttgtcc |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35935553 |
agtattgtggctcaatggaggtaaaaatagcctcacaaactgttttatgctgataataacttttgtcc |
35935486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 72
Target Start/End: Complemental strand, 35928912 - 35928863
Alignment:
| Q |
21 |
ttgtggctcaatggaggtaaaaatagcctcacaaactgttttatgctgataa |
72 |
Q |
| |
|
||||||||||||||||||| |||| |||| |||||| |||||||||||||| |
|
|
| T |
35928912 |
ttgtggctcaatggaggtataaattgcct--caaacttttttatgctgataa |
35928863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 35941103 - 35941063
Alignment:
| Q |
17 |
agtattgtggctcaatggaggtaaaaatagcctcacaaact |
57 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| ||||| |
|
|
| T |
35941103 |
agtattatggctcaatggaggtaaaaatagtctcataaact |
35941063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University