View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4203_high_9 (Length: 248)

Name: NF4203_high_9
Description: NF4203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4203_high_9
NF4203_high_9
[»] chr1 (1 HSPs)
chr1 (85-227)||(4858777-4858919)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 85 - 227
Target Start/End: Complemental strand, 4858919 - 4858777
Alignment:
85 gaaggagcaaaatagtaattgactcctgctgtactcattgagtaataatggagtaattttatattcgaattcttcttgatgaatgggaaaatatgtcctt 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4858919 gaaggagcaaaatagtaattgactcctgctgtactcattgagtaataatggagtaattttatattcgaattcttcttgatgaatgggaaaatatgtcctt 4858820  T
185 gaagctcatgcatggaggaccatagcatggttgatgagccatg 227  Q
    |||||||||||||||||||||||| ||||||||||||||||||    
4858819 gaagctcatgcatggaggaccataacatggttgatgagccatg 4858777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University