View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4203_low_16 (Length: 236)
Name: NF4203_low_16
Description: NF4203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4203_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 32264704 - 32264485
Alignment:
| Q |
1 |
aatcatagaaaaagtattcaatacaggttaaaaacaagttgtagattcaaccaagtccctctcccccttaatgttggtcttagtttaagggaaaatttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32264704 |
aatcatagaaaaagtattcaatacaggttataaacaagttgtagattcaaccaagtccctctcccccttaatgttggtcttagtttaagggaaaatttgt |
32264605 |
T |
|
| Q |
101 |
gtagctcacggaacacaattttaatgttaagcacgaggcgctcaactagtgcgcatgaaaaccctgccctgatgactgcacggagcactataatgtgttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32264604 |
gtagctcacggaacacaattttaatgttaagcacgaggcgctcaactagtgcgcatgaaaacctcgccctgatgactgcacggagcactataatgtgttg |
32264505 |
T |
|
| Q |
201 |
agccccgagaaacatttgat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32264504 |
agccccgagaaacatttgat |
32264485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 65 - 206
Target Start/End: Complemental strand, 32255577 - 32255436
Alignment:
| Q |
65 |
cccttaatgttggtcttagtttaagggaaaatttgtgtagctcacggaacacaattttaatgttaagcacgaggcgctcaactagtgcgcatgaaaaccc |
164 |
Q |
| |
|
|||||| |||||||||||||||| |||||| |||||| ||||||||||||| |||||| |||| ||| ||||| | |||||||||| ||||||||||| |
|
|
| T |
32255577 |
cccttattgttggtcttagtttaggggaaagtttgtgaagctcacggaacagaatttttatgtcaagtgtgaggcacccaactagtgcccatgaaaaccc |
32255478 |
T |
|
| Q |
165 |
tgccctgatgactgcacggagcactataatgtgttgagcccc |
206 |
Q |
| |
|
||||| ||||| ||| | |||| | ||||||||||||||| |
|
|
| T |
32255477 |
cgccctaatgaccgcatgtagcattgcaatgtgttgagcccc |
32255436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 66 - 206
Target Start/End: Complemental strand, 23203314 - 23203167
Alignment:
| Q |
66 |
ccttaatgttggtcttagtttaagggaaaatttgtgtagctcacggaacacaattttaatgttaagcacgaggcgctcaactagtgcgca-tgaaaaccc |
164 |
Q |
| |
|
|||||||| |||||| ||||| |||||| |||||| ||||||||||||| ||||||||| |||| ||| ||||| |||||||||||| ||||||| | |
|
|
| T |
23203314 |
ccttaatgctggtctatgtttaggggaaagtttgtgaagctcacggaacatgtttttaatgtcaagcgcgaagcgctaaactagtgcgcattgaaaactc |
23203215 |
T |
|
| Q |
165 |
tgccc------tgatgactgcacggagcactataatgtgttgagcccc |
206 |
Q |
| |
|
|||| | ||||| |||||||||||| |||||||||||||||| |
|
|
| T |
23203214 |
cgccctaatattaatgaccgcacggagcactgtaatgtgttgagcccc |
23203167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University