View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4205_high_22 (Length: 244)
Name: NF4205_high_22
Description: NF4205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4205_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 47075647 - 47075880
Alignment:
| Q |
1 |
ctctcatcccaatctggacgtctttgatcaccaaacagaagcttttcaagtgatccgttgctcatgtattcataaaccaaaagcctttttgaaccctcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47075647 |
ctctcatcccaatctggacgtctttgatcaccaaacagaagcttttcaagtgatccgttgctcatgtattcataaaccaaaagcctttttgaaccctcat |
47075746 |
T |
|
| Q |
101 |
gacaaaaacccagcaatctaactaggttcctgtggtgggttttcccaatggatctcacttctgcttgaaattccctttccccatcttccaccaccttctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47075747 |
gacaaaaacccagcaatctaactaggttcctgtggtgggttttcccaatggatctcacttctgcttgaaattccctttccccatcttccaccaccttctc |
47075846 |
T |
|
| Q |
201 |
tagtctcttcactgcaatcaatctcttacctttg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47075847 |
tagtctcttcactgcaatcaatctcttacctttg |
47075880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 47068683 - 47068450
Alignment:
| Q |
1 |
ctctcatcccaatctggacgtctttgatcaccaaacagaagcttttcaagtgatccgttgctcatgtattcataaaccaaaagcctttttgaaccctcat |
100 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47068683 |
ctctcattccaatctgggcgtctttgatcaccaaaaagaagctttccaagtgatccgttgctcatgtattcataaaccagaagcctttttgaaccctcaa |
47068584 |
T |
|
| Q |
101 |
gacaaaaacccagcaatctaactaggttcctgtggtgggttttcccaatggatctcacttctgcttgaaattccctttccccatcttccaccaccttctc |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||||||||| || || |
|
|
| T |
47068583 |
cacaaaaaccaagcaatctaactaggttcctgtggtgggttttcccaatggatctcacttctgcttgaaattccttttcaccttcttccaccactttttc |
47068484 |
T |
|
| Q |
201 |
tagtctcttcactgcaatcaatctcttacctttg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47068483 |
tagtctcttcactgcaatcaatctcttacctttg |
47068450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University