View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4205_high_27 (Length: 232)
Name: NF4205_high_27
Description: NF4205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4205_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 7992642 - 7992444
Alignment:
| Q |
18 |
agttgatcaaattgaatggttggtatggtacgatttatgacacttaatttctattatttatttttgtcgataaggttttctagccgatattgtcctcgtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
7992642 |
agttgatcaaattgaatggttggtatggtacgatttatgacacttaatttctattatttatttttgttgataagattttctagccgatattgtcctcgtg |
7992543 |
T |
 |
| Q |
118 |
caatctatttaatcattgatacactgaacttgtgatcaagttaatctctattagataatttgtttattgctaatccaccttgattagttatcattctct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7992542 |
caatctatttaatcattgatacactgaacttgtgatcaagttaatctctattagataatttgtttattgctaatccaccttgattagccatcattctct |
7992444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University