View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4205_low_32 (Length: 281)
Name: NF4205_low_32
Description: NF4205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4205_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 11 - 260
Target Start/End: Original strand, 50323680 - 50323929
Alignment:
| Q |
11 |
gcaaagggtggaaaacatttaacaaggagtagattgaaattgaatatttcaattgtcataaattagggcattctcataatggatgtcgtaactgagagga |
110 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50323680 |
gcaaagggtggaaaacatttaataaggaggagattgaaattgaatatttcaattgtcataaattaggacattctcataatggatgtcgtaactgagagga |
50323779 |
T |
 |
| Q |
111 |
aaaggagattatttccaatttaatgaagaagaaaagcttcttttgatggcagttactcaacgagaaactacttcatcaatgaagatatggttcttaggct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50323780 |
aaaggagattatttccaatttaatgaagaagaaaggcttcttttgatggcagttactcaacgagaaactacttcatcaatgaagatatggttcttaggct |
50323879 |
T |
 |
| Q |
211 |
caggttgtagtaatcacatgtgtgggtataaagagtggttatgcagctat |
260 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50323880 |
cgggttgtagtaatcacatgtgtgggtataaagagtggttatgcagctat |
50323929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University