View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4205_low_37 (Length: 244)
Name: NF4205_low_37
Description: NF4205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4205_low_37 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 36162247 - 36162022
Alignment:
| Q |
19 |
gtcatctcggatgaggttgagaatagggtcgacaaattcactttcagtcagggaaaagacatcaaaaaatgcttccagcagccaatgatgcccagtttga |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36162247 |
gtcatctctgatgaggttgagaatagggtcgacaaattcactttcagtcagggaaaagacatcaaaaaatgcttccagcagccaatgatgcccagtttga |
36162148 |
T |
 |
| Q |
119 |
ataatccatcatttaagaagtaaacaacgtaagtgcaagtgaaattgtgatcggcggatttaaagctgttggaactggaggaaggtgtgacgagaggttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36162147 |
ataatccatcatttaagaagtaaacaaagtaagtgcaagtgaaattgtgatcggcggatttaaagctgttggaactggaggaaggtgtgacgagaggttt |
36162048 |
T |
 |
| Q |
219 |
ggtcaaagatatgtgttgagagtcaa |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36162047 |
ggtcaaagatatgtgttgagagtcaa |
36162022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 20 - 95
Target Start/End: Complemental strand, 24525192 - 24525117
Alignment:
| Q |
20 |
tcatctcggatgaggttgagaatagggtcgacaaattcactttcagtcagggaaaagacatcaaaaaatgcttcca |
95 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||| |
|
|
| T |
24525192 |
tcatctcggatgcagttgagaatagggtcgacaaattcactctctctcagggaaaagacatcaagaaatgcttcca |
24525117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 34 - 95
Target Start/End: Complemental strand, 30078344 - 30078283
Alignment:
| Q |
34 |
gttgagaatagggtcgacaaattcactttca-gtcagggaaaagacatcaaaaaatgcttcca |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||| || | |||||||||||| | ||||||||||| |
|
|
| T |
30078344 |
gttgagaatagggtcgacaaattcactttcacgtga-ggaaaagacatcgagaaatgcttcca |
30078283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 95
Target Start/End: Original strand, 25896124 - 25896197
Alignment:
| Q |
22 |
atctcggatgaggttgagaatagggtcgacaaattcactttcagtcagggaaaagacatcaaaaaatgcttcca |
95 |
Q |
| |
|
|||||||| | | ||||||||||||||||||||||| |||||| |||||||||| |||| ||||||||||| |
|
|
| T |
25896124 |
atctcggaggtgtttgagaatagggtcgacaaattcgctttcaactggggaaaagacgtcaagaaatgcttcca |
25896197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 25 - 94
Target Start/End: Complemental strand, 17772618 - 17772549
Alignment:
| Q |
25 |
tcggatgaggttgagaatagggtcgacaaattcactttcagtcagggaaaagacatcaaaaaatgcttcc |
94 |
Q |
| |
|
||||| |||| |||| |||||||||||||||||||||||| ||||||||||||||||| | |||||||| |
|
|
| T |
17772618 |
tcggaggaggctgagcatagggtcgacaaattcactttcacgcagggaaaagacatcaagatatgcttcc |
17772549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University