View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4206_low_1 (Length: 480)
Name: NF4206_low_1
Description: NF4206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4206_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 4e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 266 - 463
Target Start/End: Original strand, 42841776 - 42841972
Alignment:
| Q |
266 |
acgtttgactgggctaaacgtgagttttgggttggagatgtgcatccaaagcaattatacttgcgtatatccatatagtatgaactacatatagctcgtc |
365 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42841776 |
acgtttgactagactaaacgtgagttttgggttggagatgtgcatcccaagcaattatacttgcgtatatctatatagtatgaactacatatagctcgtc |
42841875 |
T |
|
| Q |
366 |
acatttctaacaatattttcaacannnnnnnnnattcaatattttgcttataaagcttcaacactcttcgtttattggaagttgaaatagattgcaca |
463 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |||||| | ||||||| |||| |
|
|
| T |
42841876 |
acatttctaacaatattttcaaca-tttttttaattcaatattttgcttataaagcttcaacactcttcttttatttgaagttcatatagatttcaca |
42841972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University