View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4206_low_7 (Length: 256)
Name: NF4206_low_7
Description: NF4206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4206_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 3895180 - 3895045
Alignment:
| Q |
1 |
tgcatcataagcataatctctagccttctctccagcattctcagccttctctgcagccctatttgttccttctctggctttatcccacacagaacctgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3895180 |
tgcatcataagcataatctctagccttctctccagcattctcagccttctctgcagccctatttgttccttctctggctttatcccacacagaacctgct |
3895081 |
T |
|
| Q |
101 |
gcttcattggttctgtcttttacctcataagcatag |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3895080 |
gcttcattggttctgtcttttacctcataagcatag |
3895045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 5 - 99
Target Start/End: Complemental strand, 3895056 - 3894962
Alignment:
| Q |
5 |
tcataagcataatctctagccttctctccagcattctcagccttctctgcagccctatttgttccttctctggctttatcccacacagaacctgc |
99 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |||||||||||||| || | |||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
3895056 |
tcataagcatagtctctagctttctctccagcattctctgccttctctgcagctctgtctgttccttctttggctttctcccacattgaacctgc |
3894962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 204 - 238
Target Start/End: Complemental strand, 3894986 - 3894952
Alignment:
| Q |
204 |
tggctttctcccacattgaacctgcagcatctttt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3894986 |
tggctttctcccacattgaacctgcagcatctttt |
3894952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 3895312 - 3895271
Alignment:
| Q |
1 |
tgcatcataagcataatctctagccttctctccagcattctc |
42 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
3895312 |
tgcatcataagcataatctctagctttctccccagcactctc |
3895271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University