View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4207_low_9 (Length: 239)
Name: NF4207_low_9
Description: NF4207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4207_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 17356046 - 17356249
Alignment:
| Q |
1 |
tgtttttgctagaattttattattgaaattgattttattgagttaaatcaatgttttgggattttggagattttgttgatttgtattattgtgtgcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17356046 |
tgtttttgctagaattttattattgaaattgattttattgagttaaatcaatattttgggattttggagattttgttgatttgtattattgtgtgcttca |
17356145 |
T |
|
| Q |
101 |
tgcgaacttcgatttcgtgatttgttgttttccttcaccttattgtttgtagaaaagcagcatataattgttttggatttttcatgaaaaattattctaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17356146 |
tgcgaacttcgatttcgtgatttgttgtttttcttcaccttcttgtttgtacaaaagcagc--ataattgttttggatttttcatgaaaaattattctaa |
17356243 |
T |
|
| Q |
201 |
attcat |
206 |
Q |
| |
|
|||||| |
|
|
| T |
17356244 |
attcat |
17356249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 3 - 161
Target Start/End: Complemental strand, 36620110 - 36619953
Alignment:
| Q |
3 |
tttttgctagaattttattattgaaattgattttattgagttaaatcaatgttttgggattttggagattttgttgatttgtattattgtgtgcttcatg |
102 |
Q |
| |
|
|||||||| ||| ||| ||||||||||| ||||||||||| | |||| | |||||||||||| || ||||||||| || |||| || |||| |||||| |
|
|
| T |
36620110 |
tttttgcttgaaattttttattgaaattaattttattgagctgaatctaggttttgggattt-ggtttttttgttgaattttattgttttgtgtttcatg |
36620012 |
T |
|
| Q |
103 |
cgaacttcgatttcgtgatttgttgttttccttcaccttattgtttgtagaaaagcagc |
161 |
Q |
| |
|
||||||| |||| | | |||||||||||||||||| ||||||||| || | ||||||| |
|
|
| T |
36620011 |
tgaacttcaattttgcgttttgttgttttccttcactttattgtttctacagaagcagc |
36619953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University