View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4208_high_5 (Length: 225)
Name: NF4208_high_5
Description: NF4208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4208_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 218
Target Start/End: Complemental strand, 12666408 - 12666203
Alignment:
| Q |
13 |
aaagggaaaagggactagacagaacggagagagaagaggagaaggaagatgaaggaaattgattttgaattggaattggatttagggttagggtatggag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12666408 |
aaagggaaaagggactagacagaacggagagagaagaggagaaggaagatgaaggaaattgattttgaattggaattggatttagggttagggtatggag |
12666309 |
T |
 |
| Q |
113 |
tggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtggtggtggttatgaagatttatgtgatattgttgtttgtgatggtgttgttg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
12666308 |
tggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtggtggtggtgatgaagatttatgtgatattgttgttggtgatgttgttgttg |
12666209 |
T |
 |
| Q |
213 |
ttgatg |
218 |
Q |
| |
|
|||||| |
|
|
| T |
12666208 |
ttgatg |
12666203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 218
Target Start/End: Original strand, 667905 - 668110
Alignment:
| Q |
13 |
aaagggaaaagggactagacagaacggagagagaagaggagaaggaagatgaaggaaattgattttgaattggaattggatttagggttagggtatggag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
667905 |
aaagggaaaagggactagacagaacggagagagaagaggagaaggaagatgaaggaaattgattttgaattggaattggaattagggttagggtatggag |
668004 |
T |
 |
| Q |
113 |
tggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtggtggtggttatgaagatttatgtgatattgttgtttgtgatggtgttgttg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
668005 |
tggaggtgcgtggtgtaacgaagctacagtgcggttggtgttgatagtggtggtggtgatgaagatttatgtgatattgttgttggtgatgttgttgttg |
668104 |
T |
 |
| Q |
213 |
ttgatg |
218 |
Q |
| |
|
|||||| |
|
|
| T |
668105 |
ttgatg |
668110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 86
Target Start/End: Complemental strand, 21914154 - 21914081
Alignment:
| Q |
13 |
aaagggaaaagggactagacagaacggagagagaagaggagaaggaagatgaaggaaattgattttgaattgga |
86 |
Q |
| |
|
|||||||||||||| || | ||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21914154 |
aaagggaaaagggagtaaagagaacggagagagaatagaagaaggaagatgaaggaaattgattttgaattgga |
21914081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 89 - 168
Target Start/End: Complemental strand, 21913970 - 21913891
Alignment:
| Q |
89 |
tggatttagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtggtggtgg |
168 |
Q |
| |
|
|||| ||||||||||||| |||||||| ||||||||||| |||| || || ||| || ||||||||| |||||||||| |
|
|
| T |
21913970 |
tggagttagggttagggtttggagtggtggtgcgtggtggaacggagagacggtgggggcggtgttggtggtggtggtgg |
21913891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University