View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4209_high_11 (Length: 261)
Name: NF4209_high_11
Description: NF4209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4209_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 8167187 - 8167033
Alignment:
| Q |
1 |
cttgcaaggcaaaaatattcatataactactcaatcttgaatgattgttatgatgaacgacaataacactacaaataggtcggtggatatcaatttcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8167187 |
cttgcaaggcaaaaatattcatataactactcaatcttgaatgattgttatgatgaacgacaataacactacaaataggtcggtggatatcaatttcttc |
8167088 |
T |
|
| Q |
101 |
aaggttttaatttttcgtatgcttttctttttaagggttcttgatttaggacact |
155 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8167087 |
aaggttttaatttttcatatgcttttctttttgagggttcttgatttaggacact |
8167033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 247
Target Start/End: Complemental strand, 8166981 - 8166941
Alignment:
| Q |
207 |
gtatatcgttcttgattaatagcatctttctagttgttatt |
247 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8166981 |
gtatatcgttcttgattaatggcatctttctagttgttatt |
8166941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University