View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4209_high_2 (Length: 455)
Name: NF4209_high_2
Description: NF4209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4209_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 3e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 3e-92
Query Start/End: Original strand, 231 - 410
Target Start/End: Original strand, 37322957 - 37323136
Alignment:
| Q |
231 |
tctctctctttttctcaagaaaatgcaaagcaatggggctttccaaattgaaagcatatcacacgctctctccctgcagatttgcttcctatattaatga |
330 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37322957 |
tctctctctctttctcaagaaaatgcaaagcaatggggctttccaaattgaaagcatatcacacgctctctccctgcagatttgcttcccatattaatga |
37323056 |
T |
 |
| Q |
331 |
ctctgtctcacgcaagctggctctgctacgcctaacaccatttactactatcatgtttatcttgctcaccttcatgtcta |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37323057 |
ctctgtctcacgcaagctggctctgctacgcctaacaccatttactactatcatgtttatcttgctcaccttcatgtcta |
37323136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 111 - 239
Target Start/End: Original strand, 37322803 - 37322923
Alignment:
| Q |
111 |
aatgaattttgtaagtgaaaaatttagagtagatgaatggtagtagtgtactactacaagttctccctagctatcgggccacacatattgattactccta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37322803 |
aatgaattttgtaagtgaaaaatttagagtagatgaatg---gtagtgtactactacaagttctccctagctatcgggccacacat-----ttactccta |
37322894 |
T |
 |
| Q |
211 |
taagattcacattcattctttctctctct |
239 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
37322895 |
taagattcacattcattctctctctctct |
37322923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University