View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4209_high_5 (Length: 404)
Name: NF4209_high_5
Description: NF4209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4209_high_5 |
 |  |
|
| [»] scaffold0085 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0085 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 51 - 281
Target Start/End: Complemental strand, 46561 - 46331
Alignment:
| Q |
51 |
aagaaactattaaaaaagccccaaata--tttgagagagtgggggcccaaactaagaaatcaacacgcgcgggacacatgaaactgaactgttgaaaatt |
148 |
Q |
| |
|
|||||||||||||||||| |||||| | ||| |||||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46561 |
aagaaactattaaaaaaggcccaaaaacatttaagagagtggg--cccaatctaagaaatcaacacgcgcgggacacatgatactgaactgttgaaaatt |
46464 |
T |
 |
| Q |
149 |
gaaatgtggcggtaactctcattcattcaaagcgtttgtcgcattgcgtaacagaacaacacaacaatggaagattcaggaacgattctctctcacattt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46463 |
gaaatgtggcggtaactctcattcattcaaagcgtttgtcgcattgcgtaacagaacaacacaacaatggaagattcaggaacgattctctctcacattt |
46364 |
T |
 |
| Q |
249 |
catctctcaaggaaatgctcgatcaggtaccta |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46363 |
catctctcaaggaaatgctcgatcaggtaccta |
46331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 328 - 393
Target Start/End: Complemental strand, 46279 - 46214
Alignment:
| Q |
328 |
aatcatcataatagtttcattattattgttcaattaggtcaacgaagaaatcgaagctcatattca |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279 |
aatcatcataatagtttcattattattgttcaattaggtcaacgaagaaatcgaagctcatattca |
46214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University