View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4209_low_15 (Length: 206)
Name: NF4209_low_15
Description: NF4209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4209_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 12 - 188
Target Start/End: Complemental strand, 43561965 - 43561789
Alignment:
| Q |
12 |
cagagactgcaacagccacccggtttatcacggcgttcgaatgcgaagctggggaaaatgggtatcagaaatccgcgaacctcgcaaaaaatcacgaatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43561965 |
cagagactgcaacagccacccggtttatcacggcgttcgaatgcgaagctggggaaaatgggtatcggaaatccgcgaacctcgcaaaaaatcacgaatc |
43561866 |
T |
|
| Q |
112 |
tggcttggaacttacgctactcctgaaatggcagctagagcgcatgatgttgctgctttgagtataaagggtcattc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43561865 |
tggcttggaacttacgctactcctgaaatggcagctagagcgcatgatgttgctgctttgagtataaagggtcattc |
43561789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 166
Target Start/End: Complemental strand, 36077810 - 36077744
Alignment:
| Q |
100 |
aaatcacgaatctggcttggaacttacgctactcctgaaatggcagctagagcgcatgatgttgctg |
166 |
Q |
| |
|
|||||| |||| ||||| ||||||||| |||| || ||||||||||||| ||| |||||||| |||| |
|
|
| T |
36077810 |
aaatcaagaatatggctaggaacttaccctacaccagaaatggcagctatagcacatgatgtagctg |
36077744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 55 - 170
Target Start/End: Original strand, 4268648 - 4268763
Alignment:
| Q |
55 |
cgaagctggggaaaatgggtatcagaaatccgcgaacctcgcaaaaaatcacgaatctggcttggaacttacgctactcctgaaatggcagctagagcgc |
154 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| |||||||||||| |||||||||| ||||| | | | || || ||||||||||||||||| | |
|
|
| T |
4268648 |
cgaaactggggaaaatgggtatctgaaatccgcgaaccacgcaaaaaatcaagaatctggctaggaacattctcaacaccagaaatggcagctagagcac |
4268747 |
T |
|
| Q |
155 |
atgatgttgctgcttt |
170 |
Q |
| |
|
| ||||| || ||||| |
|
|
| T |
4268748 |
acgatgtagcagcttt |
4268763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 97 - 188
Target Start/End: Complemental strand, 505615 - 505524
Alignment:
| Q |
97 |
aaaaaatcacgaatctggcttggaacttacgctactcctgaaatggcagctagagcgcatgatgttgctgctttgagtataaagggtcattc |
188 |
Q |
| |
|
||||||||| |||| ||||||||||| ||| |||| ||||||||||||||||||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
505615 |
aaaaaatcaagaatatggcttggaacataccctacagctgaaatggcagctagagcacatgatgtagctgctttagctataaagggtcattc |
505524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 61 - 188
Target Start/End: Complemental strand, 16357926 - 16357799
Alignment:
| Q |
61 |
tggggaaaatgggtatcagaaatccgcgaacctcgcaaaaaatcacgaatctggcttggaacttacgctactcctgaaatggcagctagagcgcatgatg |
160 |
Q |
| |
|
||||||||||||||||| ||||| || || || | || || ||| |||| ||||||||||| ||| |||| ||||||||||||||||||| ||||||| |
|
|
| T |
16357926 |
tggggaaaatgggtatctgaaattcgtgagccaagaaagaagtcaagaatatggcttggaacataccctacagctgaaatggcagctagagctcatgatg |
16357827 |
T |
|
| Q |
161 |
ttgctgctttgagtataaagggtcattc |
188 |
Q |
| |
|
| |||||||| |||||||||||||| |
|
|
| T |
16357826 |
tagctgctttagccataaagggtcattc |
16357799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 50 - 143
Target Start/End: Original strand, 33589193 - 33589286
Alignment:
| Q |
50 |
gaatgcgaagctggggaaaatgggtatcagaaatccgcgaacctcgcaaaaaatcacgaatctggcttggaacttacgctactcctgaaatggc |
143 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||| ||||| || || ||| ||||||||||||||||| || ||||| |||||||||| |
|
|
| T |
33589193 |
gaatgcgaacatggggaaaatgggtatccgaaatccgtgaaccacgaaagaaaagtcgaatctggcttggaacatatgctacggctgaaatggc |
33589286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 146
Target Start/End: Original strand, 33602312 - 33602408
Alignment:
| Q |
50 |
gaatgcgaagctggggaaaatgggtatcagaaatccgcgaacctcgcaaaaaatcacgaatctggcttggaacttacgctactcctgaaatggcagc |
146 |
Q |
| |
|
||||||||| |||||||||||||| || |||||||| ||||| || || ||| ||||||||||| ||||| | ||| || ||||||||||||| |
|
|
| T |
33602312 |
gaatgcgaacatggggaaaatgggtttctgaaatccgagaaccacgaaagaaaaaccgaatctggctaggaacattcgcaaccgctgaaatggcagc |
33602408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 167
Target Start/End: Original strand, 71010 - 71116
Alignment:
| Q |
61 |
tggggaaaatgggtatcagaaatccgcgaacctcgcaaaaaatcacgaatctggcttggaacttacgctactcctgaaatggcagctagagcgcatgatg |
160 |
Q |
| |
|
|||||||| ||||| || ||||||||||| || || || ||||| || || ||||| || |||| | | ||| |||||||||| |||||||||||||| | |
|
|
| T |
71010 |
tggggaaagtgggtgtccgaaatccgcgagccacgtaagaaatcgcggatttggctaggcactttccccactgctgaaatggctgctagagcgcatgacg |
71109 |
T |
|
| Q |
161 |
ttgctgc |
167 |
Q |
| |
|
|||||| |
|
|
| T |
71110 |
ctgctgc |
71116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University