View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4211_low_12 (Length: 258)

Name: NF4211_low_12
Description: NF4211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4211_low_12
NF4211_low_12
[»] chr8 (1 HSPs)
chr8 (13-258)||(38096486-38096731)


Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 13 - 258
Target Start/End: Original strand, 38096486 - 38096731
Alignment:
13 gcagagatgaaagcaaagcagcaggaagggaggctgagcaatgtggggaccacaagcaaaagaagggagagtgttgatgaagagaaagtgtattctggtg 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||    
38096486 gcagagatgaaagcaaagcagcaggaagggaggctgagcaatgtggggacaacaagcaagagaagggagagtgttgatgaagagaaagtgtattctggtg 38096585  T
113 atgaagatatatgtgtaacggagaatccaaggttgatggggaatttgcagagtgaagagaaggaatactttagtgggagtattgtggaatccatgaaagc 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38096586 atgaagatatatgtgtaacggagaatccaaggttgatggggaatttgcagagtgaagagaaggaatactttagtgggagtattgtggaatccatgaaagc 38096685  T
213 aaaccgggttgcttttcaagctgaacctgtgctcaagaaatctaat 258  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
38096686 aaaccgggttgcttttcaagctgaacctgtgctcaagaaatctaat 38096731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University