View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4211_low_16 (Length: 211)
Name: NF4211_low_16
Description: NF4211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4211_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 24 - 194
Target Start/End: Original strand, 6074266 - 6074436
Alignment:
| Q |
24 |
gacactgacacatgaacaccggtgataatctcagaaaataaattatataaacataatcacatgtgttggtatcggacacctgccacacctttgattagag |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6074266 |
gacactgacacatgaacaccggtgataatctcagaaaataaattatataaacataatcacatgtgttggtatcggacacctgccacacctttgattagag |
6074365 |
T |
|
| Q |
124 |
ttgttagtgctatggagggtgtaacaaattaggtttttgtttacttgatcttcctactactgatagtgcat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6074366 |
ttgttagtgctatggagggtgtaacaaattaggtttttgtttacttgatcttcctactactggtagtgcat |
6074436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 44 - 165
Target Start/End: Original strand, 6074519 - 6074640
Alignment:
| Q |
44 |
ggtgataatctcagaaaataaattatataaacataatcacatgtgttggtatcggacacctgccacacctttgattagagttgttagtgctatggagggt |
143 |
Q |
| |
|
||||||||| | ||||||| ||||| | ||| ||||||||||||||||| | ||||| || ||||||||||||||||| ||| || ||| ||| ||| |
|
|
| T |
6074519 |
ggtgataatttgagaaaatgaattagttgaacgtaatcacatgtgttggtgttagacacttgacacacctttgattagaggtgtcggtactacggaaggt |
6074618 |
T |
|
| Q |
144 |
gtaacaaattaggtttttgttt |
165 |
Q |
| |
|
||||| ||| |||||||||||| |
|
|
| T |
6074619 |
gtaacgaatcaggtttttgttt |
6074640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 58 - 105
Target Start/End: Original strand, 4793879 - 4793926
Alignment:
| Q |
58 |
aaaataaattatataaacataatcacatgtgttggtatcggacacctg |
105 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
4793879 |
aaaattaattaattaaacataatcacatgtgttagtatcggacacctg |
4793926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University