View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4211_low_8 (Length: 295)

Name: NF4211_low_8
Description: NF4211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4211_low_8
NF4211_low_8
[»] chr2 (1 HSPs)
chr2 (19-109)||(22829077-22829167)


Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 22829077 - 22829167
Alignment:
19 atttttaacttgttttgatgaagaatttgaaagaatgatgagggagggatggaggccgagaggttagagagaatgagagggagtggagttc 109  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||    
22829077 atttttaacttgttttgatgaagaatttgaaagaatgatgggggagggatggaggccgagaggttagagagaatgagagagagtggagttc 22829167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University