View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4212_high_11 (Length: 227)
Name: NF4212_high_11
Description: NF4212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4212_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 46 - 224
Target Start/End: Original strand, 6074653 - 6074831
Alignment:
| Q |
46 |
acaggatcttcctactaccagtaatgcatatgtgcatagaacatttttggcattgaaatctgacccacttaggacaagagtggatttgatacatcaacaa |
145 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6074653 |
acaggatcttcctactactggtaatgcatatgtgcatagaacatttttggcattgaaatctgacccacttaggacaagagtggatttgatacatcaacaa |
6074752 |
T |
 |
| Q |
146 |
gctaaagatcatatttcattagtgaatgcttatgctgcatatgctaggaagcttaagcttgatatttctaggcagttga |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6074753 |
gctaaagatcatatttcattagtgaatgcttatgctgcatatgctaggaagcttaagcttgatatttctaggcagttga |
6074831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 6074412 - 6074456
Alignment:
| Q |
50 |
gatcttcctactaccagtaatgcatatgtgcatagaacatttttg |
94 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
6074412 |
gatcttcctactactggtagtgcatatgtgcatagaacatttttg |
6074456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University