View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4212_high_6 (Length: 247)
Name: NF4212_high_6
Description: NF4212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4212_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 11 - 231
Target Start/End: Complemental strand, 981046 - 980826
Alignment:
| Q |
11 |
caaaggagggcgtacgaaatggtttgttctaatgtg-agaatcatattttggttgtatttttgcaaatttagtttcaggttacctaccatactataactt |
109 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||||| | |||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
981046 |
caaaggagggcatacgaaatggtt-gttccaatgtgtaaaatcatattttggtagtatttttgcaaatttagtttcaggttacctatcatactctaactt |
980948 |
T |
 |
| Q |
110 |
tttctttgctttaacataatgtgataggagacagatttgagaagacccatttgtcgagctgaggttatagtgacaacttggttaaggaaagacagaacct |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
980947 |
tttctttgctttaacataatatgataggagacagaattgagaagacccatttgtcgagctgaggttatagtgacaacttggttgaagaaagacggaacct |
980848 |
T |
 |
| Q |
210 |
attcaactaaatatgcagaaaa |
231 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
980847 |
attcaactaaatatgcagaaaa |
980826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University