View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4212_high_9 (Length: 229)
Name: NF4212_high_9
Description: NF4212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4212_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 36 - 216
Target Start/End: Original strand, 54151165 - 54151334
Alignment:
| Q |
36 |
atactctaatgaagaggcttcaaagtggatggcgagtctttccctcacagataacactccaaaggtaaatttcagctagttttcaaacaaaaatgattgc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54151165 |
atactctaatgaagaggcttcaaagtggatggcgagtctttccctcacagataacactccaaaggtaaatttc-----------aaacaaaaatgattgc |
54151253 |
T |
 |
| Q |
136 |
tgctatattttattgaactgattcattttggattgatattcactctgtgagtaatgaaatcttgaatcattgcttcatctc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
54151254 |
tgctatattttattgaactgattcattttggattgatattcactctgtgagtattgaaatcttgaatcattgcttcttctc |
54151334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University