View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4213_high_4 (Length: 368)
Name: NF4213_high_4
Description: NF4213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4213_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 7e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 5042569 - 5042432
Alignment:
| Q |
1 |
aatagaaccttataatatcacatatagtctccaaaatgtgatgtttcaatgtcagaacctattattgtggtgacacattccattgtcacaactcacaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5042569 |
aatagaaccttataatatcacatatagtctccaaaatgtgatgtttcaatgtcaagacctattattgtggtgacacattccattgtcacaactcacaagg |
5042470 |
T |
 |
| Q |
101 |
aaaattattgtacgactcttttttctactttgttttat |
138 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5042469 |
aagattattgtacgactcttttttctactttgttttat |
5042432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 130 - 351
Target Start/End: Complemental strand, 5042247 - 5042031
Alignment:
| Q |
130 |
ttgttttattacttaccggttgagtttattatgagacaaaccaattgcagaggcagatacttattttgctatgagatcctttggtgt----atatatata |
225 |
Q |
| |
|
||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |||| ||||||||| |
|
|
| T |
5042247 |
ttgttttattacttagcggttgaatttattataagacaaaccaattgcagaggcggatacacattttgctatgagatcctttagtgtgtgtatatatata |
5042148 |
T |
 |
| Q |
226 |
ctcccttttgcannnnnnnnnnnnnnnnnnnnntttgtacatataatatatagttttggattattgtttggatagaggctcgtcaaccaaaggagaggta |
325 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5042147 |
ctcccttttgcaattattattatt---------tttgtacatataatatatagttttggattattgtttggatagaggctcgtcaaccaaaggagaggta |
5042057 |
T |
 |
| Q |
326 |
tttcccttttcagggctcctcctttt |
351 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5042056 |
tttcccttttcagggctcctcctttt |
5042031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University