View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4214_low_10 (Length: 241)
Name: NF4214_low_10
Description: NF4214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4214_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 86 - 155
Target Start/End: Complemental strand, 5519291 - 5519222
Alignment:
| Q |
86 |
ccatactcaacacaaacaatcatattcttctagtatattcttgttttggtaaataacattcttctgtttt |
155 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||| |||| |
|
|
| T |
5519291 |
ccatcctcaacacaaacaatcatattcttctagtatattattgttttagtaaataacactcttctatttt |
5519222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 66 - 97
Target Start/End: Original strand, 37841531 - 37841562
Alignment:
| Q |
66 |
ctcttttgtgtatatatgagccatactcaaca |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37841531 |
ctcttttgtgtatatatgagccatactcaaca |
37841562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University