View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4214_low_3 (Length: 507)
Name: NF4214_low_3
Description: NF4214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4214_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 7e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 353 - 489
Target Start/End: Original strand, 25493143 - 25493272
Alignment:
| Q |
353 |
tggttttaattgcatgcttttcagtttttgctagggtaatttatttgtaaatgtgtgagaggggtgagaaaaggtttaactttttctgtttcgcatgtat |
452 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| || ||| |||||||| |
|
|
| T |
25493143 |
tggttttaattgcatgcttttcagtttttgctagggtaagttatttgtatatgtgtgagaggggtgagaaaaggtttacct-------tttggcatgtat |
25493235 |
T |
|
| Q |
453 |
gctttcaccatgaagttacttcatcaacaaagctata |
489 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25493236 |
gctttcaccatgaagttacttcatcagcaaagctata |
25493272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 15 - 114
Target Start/End: Original strand, 25492986 - 25493085
Alignment:
| Q |
15 |
ctaagaagtttctaaacctagtagaaccctcctattttgttatcatttgactctcacatcaatctattatacatcttgtcccgaattatgtcgctgtatt |
114 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| ||||||| ||||||||| |
|
|
| T |
25492986 |
ctaagaagtttctaaacccagtagaaccctcctattttgttatcatttgactctcacatcaatctattatacatttcttcccaaattatggcgctgtatt |
25493085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 195 - 248
Target Start/End: Complemental strand, 39615819 - 39615766
Alignment:
| Q |
195 |
attagttcttattttctctgcttcctttattccttctatgataaactattacat |
248 |
Q |
| |
|
||||||||||| | || |||||||||||||| | ||||||||||||||||||| |
|
|
| T |
39615819 |
attagttcttactggctgtgcttcctttattcatcctatgataaactattacat |
39615766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University