View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4215_low_19 (Length: 304)
Name: NF4215_low_19
Description: NF4215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4215_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 19 - 292
Target Start/End: Complemental strand, 4121794 - 4121521
Alignment:
| Q |
19 |
atcataccatttgatcttttaggtcaagacatcacctcgacggttatttgatgcttgcattgagaattgtcattcttttcatttctatttttgatttgtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4121794 |
atcataccatttgatcttttaggtcaagacgtcacctcgacggttatttgatgcttgcattgagaattgtcattcttttcatttctattttagatttgtg |
4121695 |
T |
 |
| Q |
119 |
gaatttggttttgttggctaatgtaggggatttctctttctgggggtaagctctagaactgtttgagagtttgtacccttgatgttgagcacaagagcat |
218 |
Q |
| |
|
|| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4121694 |
gattttggttttgttggctaatgtaggagatttctctttctgggggtaagctctagaactgtttgagagtttgtacccttgatgttgagcataagagcat |
4121595 |
T |
 |
| Q |
219 |
cctgccgactgcaaacaatatttcgttaaacttcttcccgactgcagctggactatattcgtcggccacaggtt |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4121594 |
cctgccgactgcaaacaatatttcgttaaacttcttcccgactgcagctggactatattcgttggccacaggtt |
4121521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 68 - 159
Target Start/End: Original strand, 4347133 - 4347224
Alignment:
| Q |
68 |
gatgcttgcattgagaattgtcattcttttcatttctatttttgatttgtggaatttggttttgttggctaatgtaggggatttctctttct |
159 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||| |
|
|
| T |
4347133 |
gatgctcgcattgagaattgtcattcttttcctttctatttttgatttgtggaatttggttttgctggctagtgtaggagatttctctttct |
4347224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 68 - 168
Target Start/End: Complemental strand, 4118762 - 4118662
Alignment:
| Q |
68 |
gatgcttgcattgagaattgtcattcttttcatttctatttttgatttgtggaatttggttttgttggctaatgtaggggatttctctttctgggggtaa |
167 |
Q |
| |
|
|||||||||||| ||| |||||| ||||||| ||||||||||| |||| |||||||| |||||||||| | |||||| |||||||||||||||| |||| |
|
|
| T |
4118762 |
gatgcttgcattaagatttgtcactcttttcctttctattttttatttatggaatttagttttgttgggcagtgtaggagatttctctttctgggtgtaa |
4118663 |
T |
 |
| Q |
168 |
g |
168 |
Q |
| |
|
| |
|
|
| T |
4118662 |
g |
4118662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 68 - 159
Target Start/End: Original strand, 4363559 - 4363650
Alignment:
| Q |
68 |
gatgcttgcattgagaattgtcattcttttcatttctatttttgatttgtggaatttggttttgttggctaatgtaggggatttctctttct |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||| ||| ||||||||||| ||||| |||||| |||||| |||||| |
|
|
| T |
4363559 |
gatgcttgcattgagaattgtcattcttttcctttctatttatgattggtgtgatttggttttgctggctggtgtaggagatttccctttct |
4363650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 76 - 131
Target Start/End: Complemental strand, 4131589 - 4131534
Alignment:
| Q |
76 |
cattgagaattgtcattcttttcatttctatttttgatttgtggaatttggttttg |
131 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
4131589 |
cattgagaattgtcattcttttcctttctatttttgattggtggaatttggttttg |
4131534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 65
Target Start/End: Original strand, 18151830 - 18151876
Alignment:
| Q |
19 |
atcataccatttgatcttttaggtcaagacatcacctcgacggttat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18151830 |
atcataccatttgatcttttaggtcaagacgtcacctcgacggttat |
18151876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 65
Target Start/End: Complemental strand, 28372560 - 28372514
Alignment:
| Q |
19 |
atcataccatttgatcttttaggtcaagacatcacctcgacggttat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28372560 |
atcataccatttgatcttttaggtcaagacgtcacctcgacggttat |
28372514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 65
Target Start/End: Complemental strand, 28380382 - 28380336
Alignment:
| Q |
19 |
atcataccatttgatcttttaggtcaagacatcacctcgacggttat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28380382 |
atcataccatttgatcttttaggtcaagacgtcacctcgacggttat |
28380336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University