View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4215_low_30 (Length: 243)
Name: NF4215_low_30
Description: NF4215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4215_low_30 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 4 - 243
Target Start/End: Complemental strand, 3152087 - 3151851
Alignment:
| Q |
4 |
attattctcctcgatgaaacttattgtggaattgattataaggagtgtgatgataccaacgaagtcttgccaatcgggtggtttattctaaagaataaga |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3152087 |
attattctcctcgatgaaacttattgtggaattgattataaggagtgtgatgataccaacgaagtcttgccaatcgggtggtttattctaaagaataaga |
3151988 |
T |
 |
| Q |
104 |
agataaaaaataatcaagaaattttaatacaatgccaaaaaagaaccttctacaactatttcttgaagtttttgtcctattatgtgcatcgcacacactt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3151987 |
---taaaaaataatcaagaaattttaatacaatgccaaaaaagaaccttctacaactatttcttgaagtttttgtcctattatgtgcatcgcacacactt |
3151891 |
T |
 |
| Q |
204 |
caaaatcaaaatcgttgttttaaattgcacaaccacaatt |
243 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3151890 |
caaaatcaaaatcattgttttaaattgcacaaccacaatt |
3151851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University