View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4215_low_36 (Length: 227)
Name: NF4215_low_36
Description: NF4215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4215_low_36 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 3151625 - 3151845
Alignment:
| Q |
7 |
cctctttcatgggtgatggaagctgcagcaatcatggctattgctttggccaatggaggagtacgctgcagaacactcttactcatttatttttgttgag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3151625 |
cctctttcatgggtgatggaagctgcagcaatcatggctattgctttggccaatggaggagtacgctgcagaacactcttactcatttctttttgttgag |
3151724 |
T |
|
| Q |
107 |
aaaattaatattcatcatggttttaaattgtagttgcggctgcgaatctttacattgcgatgaaatacggccaatgcaattgcgatgttgttgctgaaac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3151725 |
aaaattaatattcatcatggttttaaattgtagttgcggctgcgaatctttacattgcgatgaaatacggccaatgcaattgcgatgttgttactgaaac |
3151824 |
T |
|
| Q |
207 |
cgcgaaatgctttatattgct |
227 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
3151825 |
ctcgaaatgctttatattgct |
3151845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 13 - 71
Target Start/End: Complemental strand, 45200220 - 45200162
Alignment:
| Q |
13 |
tcatgggtgatggaagctgcagcaatcatggctattgctttggccaatggaggagtacg |
71 |
Q |
| |
|
|||||||| ||||||||||| || |||||||||||||| ||||| |||||||| ||||| |
|
|
| T |
45200220 |
tcatgggtcatggaagctgctgctatcatggctattgcattggcaaatggaggggtacg |
45200162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 63
Target Start/End: Complemental strand, 1499347 - 1499297
Alignment:
| Q |
13 |
tcatgggtgatggaagctgcagcaatcatggctattgctttggccaatgga |
63 |
Q |
| |
|
|||||||| ||||||||||| || |||||||| ||||||||||| |||||| |
|
|
| T |
1499347 |
tcatgggttatggaagctgctgctatcatggccattgctttggctaatgga |
1499297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University