View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4216_low_11 (Length: 225)
Name: NF4216_low_11
Description: NF4216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4216_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 17751537 - 17751346
Alignment:
| Q |
18 |
tataatttgtcaatactcattttattttcaactagtactaataggcatcttgacaagagacagacaccattactgattagctattgatttaattttccag |
117 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17751537 |
tataatttgttaatactccttttattttcaacaagtactaataggcatcttgacaagagacagacaccattactgattagctattgatttaattttccag |
17751438 |
T |
 |
| Q |
118 |
aaattgatccaactataaattgccnnnnnnntctggttgttataattgacatgagacaaatgtttttctatgcaatagctgtagtagagaata |
210 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
17751437 |
aaattgatccaactataaattgccgggggggtctggttgttataattgacatgagacaaatg-tattctatgcaatagctgtagtagagaata |
17751346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 178
Target Start/End: Complemental strand, 17750683 - 17750620
Alignment:
| Q |
115 |
cagaaattgatccaactataaattgccnnnnnnntctggttgttataattgacatgagacaaat |
178 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
17750683 |
cagaaattgatccaaccataaattgccgggggggtctggtggttataattggcatgagacaaat |
17750620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University