View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4216_low_5 (Length: 266)
Name: NF4216_low_5
Description: NF4216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4216_low_5 |
 |  |
|
| [»] scaffold0533 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0533 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: scaffold0533
Description:
Target: scaffold0533; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 64 - 247
Target Start/End: Original strand, 7481 - 7664
Alignment:
| Q |
64 |
gtattatttatagtggtgtttatatcattttacaacgtcctcgagtgaatccaaactcaatactatcaagttataagattaaataacacttcaagtgtaa |
163 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7481 |
gtattatttatagtggtgttaatatcattttacaacgtcctcgagtgaatctgaactcaatactatcaagttacaagattaaataacacttcaagtgtaa |
7580 |
T |
 |
| Q |
164 |
taaatcacaaccaatacaatgcgtgactataaataaagtcaattgttttaataatatgatagtgattaattaattaatattagt |
247 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7581 |
taaatcacaaccaataaaatgcgtgactataaataaagtcaattgttttaataatatgatagtgattaattaattaatattagt |
7664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0533; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 7159 - 7209
Alignment:
| Q |
18 |
tgatataccgaagagttggttcgaactcgtaataatggaaacatttgtatt |
68 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7159 |
tgatataccgaagagttggttcaaactcgtaataatggaaacatttgtatt |
7209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University