View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4216_low_9 (Length: 236)
Name: NF4216_low_9
Description: NF4216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4216_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 1001124 - 1001211
Alignment:
| Q |
1 |
aactagccatattactataacaaaaggtattgaaagcttttacagtatgatagttgagttcctataagttgcaaagaaaaatatgaaa |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| | |||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
1001124 |
aactagccatattactataacaaaaggtatttaaagcttttataatatgatagttgacttctgataagttgcaaagaaaaatatgaaa |
1001211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University