View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4217_high_12 (Length: 291)

Name: NF4217_high_12
Description: NF4217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4217_high_12
NF4217_high_12
[»] chr6 (2 HSPs)
chr6 (73-143)||(34339471-34339541)
chr6 (224-280)||(34339622-34339678)


Alignment Details
Target: chr6 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 73 - 143
Target Start/End: Original strand, 34339471 - 34339541
Alignment:
73 cactagatattatcttctttgattaatgtaacgtatctcacgctctaccgttttcacaagactagggccat 143  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34339471 cactagatattatcttctttgattaatgtaacgtatctcacgctctaccgttttcacaagactagggccat 34339541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 280
Target Start/End: Original strand, 34339622 - 34339678
Alignment:
224 gtggcaaacgataaacccacctgtcagaaaaaaccctattacatgtacggtgatgat 280  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34339622 gtggcaaacgataaacccacctgtcagaaaaaaccctattacatgtacggtgatgat 34339678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University