View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4217_low_11 (Length: 336)
Name: NF4217_low_11
Description: NF4217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4217_low_11 |
 | |
|
| [»] scaffold0004 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0004 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 319
Target Start/End: Complemental strand, 124430 - 124123
Alignment:
| Q |
12 |
catcatcaaagtccctaacagacttggcattggcaaccagtggaatgttatattcaccgccaatatcttcaaagagtaaagcatgtctgcacccaaaaat |
111 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
124430 |
catcatcaaagtctctaacagacttggcattggcaactagtggaatgttatattcaccaccaatatcttcaaagagtaaagcatgtctgcacccaaaaat |
124331 |
T |
|
| Q |
112 |
aaaagagaaaa-----gttgtcatatgtagttaaaaattagaataacgttacatcaataacata--aatttgtctcacttgttgaaaatcttggagagag |
204 |
Q |
| |
|
|||| | || | ||||||||||||||||| ||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
124330 |
aaaataaaataaaatggttgtcatatgtagtta-------gaataacattacatcaataacatataaatttgtcgcacttgttgaaaatcttggagagag |
124238 |
T |
|
| Q |
205 |
ccgaggaaagagccttgtcataaattttgttaaagccttttcgaaagtcctcatctgacacaaccaaatcgaatggattgcacaaagatacagcaccaga |
304 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
124237 |
ctgaggaaagagccttgtcataaattttgttaaagccttttcggaagtcctcatctgacacaaccaaatcgaatggattgcacaaagatacagcaccaga |
124138 |
T |
|
| Q |
305 |
aagaggacagttgtg |
319 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
124137 |
aagaggacagttgtg |
124123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University