View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4217_low_12 (Length: 326)
Name: NF4217_low_12
Description: NF4217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4217_low_12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 10 - 326
Target Start/End: Complemental strand, 36606551 - 36606238
Alignment:
| Q |
10 |
tcatctgccacatgtttctagagagcctttgaaggcttttgaaagtagtaccaaaggaatgcaagcaaccagcaacaattctgtttcatcttcagtctcc |
109 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36606551 |
tcatctgccacatgtttctaaagagcctttgaaggcttttgaaagtagtaccaaaggaatgcaagcaaccagcaac---tctgtttcatcttcagtctct |
36606455 |
T |
 |
| Q |
110 |
attcaaggatttgaactttttgacttcgcaaacacttttattgacttgagtgaaccaacaccccctgaacatgggagttttaatcacactgaaattgtgg |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36606454 |
attcaaggatttgaactttttgactttgcaaacacttttattgacttgagtgaaccaacaccccctgaacatgggagttttaatcacactgaaattgtgg |
36606355 |
T |
 |
| Q |
210 |
gatcacgtgccaacagtgatggtcctgatgaaaatatttctggtgaatcctctccgtttacaccaacttttcaaaataccattacttgtaatgagaaagt |
309 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
36606354 |
gatcacgtgccaacagtggtggtcctgatgaaaatatttctggtgaatcctctcagtttacaccaacttttcagaataccattactcgtaatgagaaagt |
36606255 |
T |
 |
| Q |
310 |
aagtcccaggttaactc |
326 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36606254 |
aagtcccaggttaactc |
36606238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University