View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4217_low_17 (Length: 261)
Name: NF4217_low_17
Description: NF4217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4217_low_17 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 19 - 261
Target Start/End: Complemental strand, 20132 - 19890
Alignment:
| Q |
19 |
cttagacactcatgaaaacagaaatattaaaagaatattgcaatagatatgagcttttaaagtaatggcttcttgtattttgccttgcttttttcaaaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20132 |
cttagacactcatgaaaacagaaatattaaaagaatattgcaatagatatgagcttttaaagtaatggcttcttgtattttgccttgcttttttcaaaag |
20033 |
T |
 |
| Q |
119 |
cacttttgtttaacttctgttaaaacataaacaagcttactcaaatttttgttagggaagaaagaactattaacttcttttgactgagaagctttcatac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20032 |
cacttttgtttaacttctgttaaaacataaacaagcttactcaaatttttgttagggaagaaagaactattagcttcttttgactgagaagctttcatac |
19933 |
T |
 |
| Q |
219 |
actagaaggtggtttaaactgggctaaggatctacggatctat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19932 |
actagaaggtggtttaaactgggctaaggatctacggatctat |
19890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University