View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4217_low_23 (Length: 238)
Name: NF4217_low_23
Description: NF4217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4217_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 20 - 222
Target Start/End: Complemental strand, 17462084 - 17461882
Alignment:
| Q |
20 |
ctcataactggatttcgacgaagacgcagtttgagttagtaaatattacaattgttgttttgaaacaatgaaataagatgtctcagcttgcaaagtcgat |
119 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17462084 |
ctcatgactggatttggacgaagacgcagtttgagttagtaaatattacaattgttgttttgaaacaatgaaataagatgtctcagcttgcaaagtcgat |
17461985 |
T |
|
| Q |
120 |
acactttagttaaattgcaaattcagcgtgaactatgcattatagcaaactcgtaactgtattcaaatattcaattggaattcaaactcgtaactgtttt |
219 |
Q |
| |
|
||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17461984 |
acattttagttaaactgcaaattcagcgtgaactatgcattatatcaaactcgtaactgtattaaaatattcaattggaattcaaactcgtaactgtttt |
17461885 |
T |
|
| Q |
220 |
aca |
222 |
Q |
| |
|
||| |
|
|
| T |
17461884 |
aca |
17461882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University