View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4217_low_24 (Length: 237)
Name: NF4217_low_24
Description: NF4217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4217_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 97 - 227
Target Start/End: Original strand, 32705504 - 32705634
Alignment:
| Q |
97 |
ataagtttttagagtgtatatggataaagagtttgataagtgcttgtctgaatgatataaggactaatatataacacataaattgtaaatatttaattta |
196 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32705504 |
ataagtttttagagtgtatatgggtaaagagtttgataagtgcttgtctctatgatataaggactaatatataacacataaattgtaaatatttaattta |
32705603 |
T |
 |
| Q |
197 |
catatatacctatttggtttggtattgatga |
227 |
Q |
| |
|
|||||||||| | |||||||||||||||||| |
|
|
| T |
32705604 |
catatataccaacttggtttggtattgatga |
32705634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University