View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4217_low_25 (Length: 230)
Name: NF4217_low_25
Description: NF4217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4217_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 214
Target Start/End: Complemental strand, 32730432 - 32730230
Alignment:
| Q |
12 |
atgaacaataaatcagaaattttaaaaatataaatcacattaattaatttttgactttgtgatcaacataaatatatgattagaaataatctagaactaa |
111 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32730432 |
atgaacaataaataagaaattttaaaaatataaatcacattaattaatttttgactttgtgatcaacataaatatatgattagaaataatctagaactaa |
32730333 |
T |
 |
| Q |
112 |
accagttgaaatgattgaatgctgaacggagatcttggttgatgttgaaatgtcaatcccatcggtgttgggactatcctttggagcaattatatgaaga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32730332 |
accagttgaaatgattgaatgctgaacggagatgttggttgatgttgaaatgtcaatcccatcggtgttgggactatcctttggagcaattatatgaaga |
32730233 |
T |
 |
| Q |
212 |
tta |
214 |
Q |
| |
|
||| |
|
|
| T |
32730232 |
tta |
32730230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 38090182 - 38090116
Alignment:
| Q |
146 |
ttggttgatgttgaaatgtcaatcccatcggtgttgggactatcctttggagcaattatatgaagat |
212 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||||||||||||| || || |||||||||||||||| |
|
|
| T |
38090182 |
ttggttgatcttgaaatatcaattccatcggtgttgggactattctccggtgcaattatatgaagat |
38090116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University