View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4218_low_18 (Length: 291)
Name: NF4218_low_18
Description: NF4218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4218_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 44 - 282
Target Start/End: Complemental strand, 21395389 - 21395157
Alignment:
| Q |
44 |
aatttaactctagtgtggttattattattcttggaaaaaatataactctagtgtggttattggtcttttaaatatatttttattattgtttctagtctag |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21395389 |
aatttaactctagtgtggttattattattcttaaaaaaaatataactctagtgtggttattggtcttttaaatatatttttattattgtttccagtcta- |
21395291 |
T |
 |
| Q |
144 |
aattgttagttatcctacgaagaatccactatcgccatgaagtgccgcactcgtaagttctcttgctagataattaggtctgcatttttcatttttaaaa |
243 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
21395290 |
----gttagttatcccacgaagaatccactatcgccatgaagtgccgcactcgtaagttctcttgctagatagttaggtctgca-ttttcatttttaaaa |
21395196 |
T |
 |
| Q |
244 |
gaaaatattattatcatctacatttacatttagaataat |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21395195 |
gaaaatattattatcatctacatttacatttagaataat |
21395157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University