View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4218_low_19 (Length: 283)
Name: NF4218_low_19
Description: NF4218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4218_low_19 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 283
Target Start/End: Original strand, 2810684 - 2810951
Alignment:
| Q |
17 |
atttatatgcattaggtttttgtttttgataagaaaatgttagttagtatgttagaaaattagtggattatgttaattttcagggtttgaactttgaacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2810684 |
atttatatgcattaggtttttgtttttgataagaaaatgttagttagtatgttagaaaattagtggattatgttaattttcagggtttgaactttgaacc |
2810783 |
T |
 |
| Q |
117 |
tccgtactcattttggtgtcccttaactcaccaaccaagctgtctgctgcgtta-gttcnnnnnnnattgtgataccatgtagaagtagaacaaaaatat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2810784 |
tccgtactcattttggtgtcccttaactcaccgaccaagctgtctgctgcgttaggttctttttttattgtgataccatgtagaagtagaacaaaaatat |
2810883 |
T |
 |
| Q |
216 |
gatcaattggtcacaaaagtactgcatgtactatttgagttgtttatttcaaatattttgttataatt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2810884 |
gatcaattggtcacaaaagtactgcatgtactatttgacttgtttatttcaaatattttgttataatt |
2810951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University