View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4218_low_20 (Length: 265)
Name: NF4218_low_20
Description: NF4218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4218_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 18 - 151
Target Start/End: Original strand, 36599218 - 36599351
Alignment:
| Q |
18 |
cttacttggatcccaagtataatatttcagattttgcaactggggtcagttttgcttctgctgctactggttatgataatgcaacttcagatgtacttgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36599218 |
cttacttggatcccaagtataatatttcagattttgcaactggggtcagttttgcttctgctgctactggttatgataatgcaacttcagatgtacttgt |
36599317 |
T |
|
| Q |
118 |
aagtccatcttctcttaatactcaaactagtgaa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36599318 |
aagtccatcttctcttaatactcaaactagtgaa |
36599351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 68 - 121
Target Start/End: Original strand, 36564272 - 36564325
Alignment:
| Q |
68 |
tttgcttctgctgctactggttatgataatgcaacttcagatgtacttgtaagt |
121 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| |||||||| |||||| |
|
|
| T |
36564272 |
tttgcttctgctggaactggatatgataatgcaacttctgatgtactagtaagt |
36564325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 50 - 111
Target Start/End: Complemental strand, 37385447 - 37385386
Alignment:
| Q |
50 |
tttgcaactggggtcagttttgcttctgctgctactggttatgataatgcaacttcagatgt |
111 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37385447 |
tttgcaactggtgtctcctttgcttctgctgctactggttatgataatgccacttcagatgt |
37385386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 26044542 - 26044623
Alignment:
| Q |
18 |
cttacttggatcccaagtataatatttcagattttgcaactggggtcagttttgcttctgctgctactggttatgataatgc |
99 |
Q |
| |
|
|||| |||||||| | ||| |||| ||||||||||| ||||| || ||||||||||||||| |||||| | ||||||||| |
|
|
| T |
26044542 |
cttatttggatcctacttatgatatatcagattttgctactggtgtttgttttgcttctgctggtactggatttgataatgc |
26044623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University