View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4218_low_21 (Length: 255)
Name: NF4218_low_21
Description: NF4218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4218_low_21 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 255
Target Start/End: Original strand, 33788858 - 33789096
Alignment:
| Q |
17 |
atgaaatcacattagtatcgtaactttgttgaagcttcaaaatgtactttttatcaaaatcatagcgacatatttgattcagtcaaactcaccatcaatc |
116 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33788858 |
atgaaatcacattattatcgtaactttgttgaagcttcaaaatatactttttatcaaaatcatagcgacacatttgattcagtcaaactcaccatcaatc |
33788957 |
T |
|
| Q |
117 |
caatcatacacaataagagttgaaaatgctacatatcaagtttggtttccgcttttgtgcgagggtttgactctgattttgatgattatttgttttgttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33788958 |
caatcatacacaataagagttgaaaatgctacatatcaagtttggtttccgcttttgtgtgagggtttgactctgattttgatggttatttgttttgttt |
33789057 |
T |
|
| Q |
217 |
tgatggtacccctaggttgagtgatgtctttataggttt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33789058 |
tgatggtacccctaggttgagtgatgtctttataggttt |
33789096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University