View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4219_high_7 (Length: 237)
Name: NF4219_high_7
Description: NF4219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4219_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 11179220 - 11179448
Alignment:
| Q |
1 |
tttgtttttggcttaatatgaatcatctttgagtcttttcgtgacgcaacattgatatcaaagttttgattcaatttgattgaggagtgagcaagatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11179220 |
tttgtttttggcttaatatgaatcatctttgagtcttttcgtgacgcaacattgatatcaaagttttgattcaatttgattgaggagtgagcaagatttt |
11179319 |
T |
 |
| Q |
101 |
tggtgttgaatcacggacacgaaaagtctcatattaaagggagagatggtgtgaggtcaagtttgagttaaaattctacattagatagaattcgtaaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11179320 |
tggtgttgaatcacggacacgaaaagtctcatattaaagggagagatggtgtgaggtcaagtttgagttaaaattctacattagatagaatccgtaaatt |
11179419 |
T |
 |
| Q |
201 |
caatgttttaaagttttgagtgatgatgt |
229 |
Q |
| |
|
|||||| |||||||||||||||| ||||| |
|
|
| T |
11179420 |
caatgtcttaaagttttgagtgaagatgt |
11179448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University