View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4220_low_5 (Length: 218)
Name: NF4220_low_5
Description: NF4220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4220_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 3 - 210
Target Start/End: Complemental strand, 39468371 - 39468166
Alignment:
| Q |
3 |
agttttgagtccgaattcacaataaaatccatgcccataattcatcaattcaatgaactactccattctcattcctctcatcttgccgccatcattgttt |
102 |
Q |
| |
|
|||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39468371 |
agttttgagttcgaattcacaacagaatccatgcccataattcatcaattcaatgaactactccattctcattcctctcatcttgccgccatcattgttt |
39468272 |
T |
 |
| Q |
103 |
cttcttcaatctgcttttacatattctcttttgtctaatccctttgattttgcttttatcatcttcttgaatctgc-tttttcatattctctcttgtcta |
201 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
39468271 |
---cttcaatctgcttttacatattctcctttgtctaatcgctttgatattgcttttatcatcttcttgaatctgctttttttatattctctcttgtcta |
39468175 |
T |
 |
| Q |
202 |
atccctttg |
210 |
Q |
| |
|
||||||||| |
|
|
| T |
39468174 |
atccctttg |
39468166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 157
Target Start/End: Complemental strand, 39468213 - 39468157
Alignment:
| Q |
102 |
tcttcttcaatctgcttttac-atattctcttttgtctaatccctttgattttgctt |
157 |
Q |
| |
|
||||||| ||||||||||| ||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
39468213 |
tcttcttgaatctgctttttttatattctctcttgtctaatccctttgattctgctt |
39468157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University