View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4222_low_3 (Length: 319)
Name: NF4222_low_3
Description: NF4222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4222_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 302
Target Start/End: Complemental strand, 469391 - 469100
Alignment:
| Q |
10 |
catcatcaacaacagcctcagcctaatgatgagagtggagaagatgctcctaatacctcacaataaccatccatggttagtaaatttgtttcgttgcatg |
109 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
469391 |
catcatcaacaacagcctcaacctaatgatgagagtggagaagatgctcctaatacctcacaataaccatccatggttag----tttgtttcgttgcatg |
469296 |
T |
|
| Q |
110 |
ctttttcatatgtaaattaa---tataattaaacattgtaatttgtgcgccaccaaatatgtgtgtactactatattagnnnnnnnnnnnggttgcagat |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||| |
|
|
| T |
469295 |
ctttttcatatgtaaattaatagtataattaaacattgtaatttgtgcgccaccaaatatgtgtgtactatattagttttttttttttttggttgcagat |
469196 |
T |
|
| Q |
207 |
tccaagttgaatttctcataactaattcattttggaaattccatggatccctatgcatgcttgagcaatggacttgagtttctcttagatgttttt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
469195 |
tccaagttgaatttctcataactaattcattttggaaattccatggatccctatgcatgctagagcaatggacttgagtttctcttagatgttttt |
469100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University