View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4222_low_4 (Length: 262)

Name: NF4222_low_4
Description: NF4222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4222_low_4
NF4222_low_4
[»] chr5 (1 HSPs)
chr5 (15-253)||(43055453-43055690)
[»] chr1 (1 HSPs)
chr1 (79-207)||(44805077-44805206)
[»] chr6 (2 HSPs)
chr6 (142-213)||(11788736-11788807)
chr6 (142-172)||(17543051-17543081)


Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 253
Target Start/End: Original strand, 43055453 - 43055690
Alignment:
15 cactattgtgttaatatcatcgacttaaatttgaaactaattttttctgcttaagnnnnnnnnaaaatttaaaatttgcatttataaagttgcaatcaca 114  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||    
43055453 cactattgtgttaatatcatcgacttaaatt-gaaactaattttttctgcttaagttttttttaaaatttaaaatttgcatttataaagttgcaatcaca 43055551  T
115 tgtttttaagtacttannnnnnncttgcaggtactgtttagacggacctgtgatttttaccaaggaagttatatggttatgtgaggattgtgacgaagaa 214  Q
    |||||||||||||||        |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
43055552 tgtttttaagtacttctttttttcttgcaggtactgtttagacggacctgtgatttttaccgaggaagttatatggttatgtgaggattgtgacgaagaa 43055651  T
215 acaggaccgtgtccaatgactgactctgaaactgatgat 253  Q
    |||||||||||||||||||||||||||||||||||||||    
43055652 acaggaccgtgtccaatgactgactctgaaactgatgat 43055690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 79 - 207
Target Start/End: Original strand, 44805077 - 44805206
Alignment:
79 aaatttaaaatttgcatttataaagttgcaatcacatgttttt-aagtacttannnnnnncttgcaggtactgtttagacggacctgtgatttttaccaa 177  Q
    ||||||||||||| |||||||||||||||||||  ||||| |  |||| |||        ||| |||||||||||||||||||||||||||||||||| |    
44805077 aaatttaaaattttcatttataaagttgcaatctaatgttctacaagtccttttttctttctttcaggtactgtttagacggacctgtgatttttaccga 44805176  T
178 ggaagttatatggttatgtgaggattgtga 207  Q
     ||||| |||||||| |||||||| |||||    
44805177 tgaagtgatatggttttgtgaggactgtga 44805206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 142 - 213
Target Start/End: Complemental strand, 11788807 - 11788736
Alignment:
142 caggtactgtttagacggacctgtgatttttaccaaggaagttatatggttatgtgaggattgtgacgaaga 213  Q
    |||||| ||||||||||| ||||||||||||||  | || ||||| ||||  |||||||||||||| |||||    
11788807 caggtattgtttagacgggcctgtgatttttacggatgaggttatttggtattgtgaggattgtgaagaaga 11788736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 172
Target Start/End: Complemental strand, 17543081 - 17543051
Alignment:
142 caggtactgtttagacggacctgtgattttt 172  Q
    |||||||||||||||||||||||||||||||    
17543081 caggtactgtttagacggacctgtgattttt 17543051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University