View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4223_low_21 (Length: 253)
Name: NF4223_low_21
Description: NF4223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4223_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 3567901 - 3568125
Alignment:
| Q |
1 |
atatagtttagtttgtttaatatatattgtagatgatgaccaagtcaatacttaatatatgcacatagtatattnnnnnnnnnnnnnnnnnnnnntatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
3567901 |
atatagtttagtttgtttaatatatattgtagatgattaccaagtcaatacttaatatatgcacataatatattaaacaaaaataaactaaaaaatatgg |
3568000 |
T |
 |
| Q |
101 |
caggggttaatagaatttacccctaacatatcaaatgtatatacattcttttacaatttgagttgcaattaattactataacttttgcttcttgtttatt |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3568001 |
taggggttaatagaattt-----------atcaaatgtatatacattcttttacaatttgagttgcaattaattactataacttttgcttcttgtttatt |
3568089 |
T |
 |
| Q |
201 |
tgcagtgaaatgggaaatgctgcctattgaactagt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3568090 |
tgcagtgaaatgggaaatgctgcctattgaactagt |
3568125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University